Assignment 8 Example | Topics and Well Written Essays - 250 words - 4

8 - Assignment Example For one to know where to draw the line when it comes to such offers, there is a criterion that has to be met for it to amount to corruption. It is important that one makes consideration on whether the action was meant to influence the person whom the offer is being made to. Secondly, that action should compel the officer to use his power to benefit himself or as a way of returning the favor. Corruption is a deviation from the ideal norms in the society. The vice is so deeply rooted in society such that there are those instances where people feel that it is permissible. Corruption permissiveness occurs where the citizens or actors are willing to justify the illegal acts in order to get away without punishment. It is important to draw the line on what amounts to corruption and what is just behavior. It is not corrupt to feel that you should appreciate someone for what they do, like in the case of giving a police officer discounted prices. It will only be corruption when one uses their position carelessly to favor some people or to get their way

Aluminium Foil ((Corporate Social Responsibility)) & Environmental Assignment

Aluminium Foil ((Corporate Social Responsibility)) & Environmental Impact - Assignment Example The availability of this element is so high that a there is very little chance of demand ever surpassing supply. Producing aluminum is a process that needs a lot of energy; in fact, the commercial growth of this metal in the late nineteenth century was predominantly as a result of the development and accessibility of inexpensive and ample hydroelectric power that has remained the key source of energy for the sector. Energy that is used in the production of aluminum is trapped in the metal, thus if aluminum is re-melted in order to make it new metal, only five percent of the energy that was used initially is needed as ninety five percent of the initial investment in energy will remain in the metal. Since the production of aluminum started, used aluminum has remained a significant source of new metal and based on the industry estimates, almost seventy percent of the aluminum in use will be recycled eventually as it is less costly compared extraction of the metal from its ore. Depending on the previous use of aluminum, the life cycle of aluminum products varies significantly. When aluminum is used in packaging in the form of a foil, it might have a life cycle of approximately a few weeks but when it is utilized as a cladding material in buildings, its life cycle may be approximately a century or even longer. This implies that aluminum has a positive profile in regards to its abundant availability, durability as well as tendency to be recycled at very low costs in terms of energy (Green, 2007, p. 125). Therefore, aluminum foil can make a significant positive contribution towards the conservation of other resources in the environment. Aluminum foil is produced from an alloy of aluminum that contains between ninety-two and ninety nine percent of aluminum, and come in numerous widths and strengths since they can be applied to thousands of applications. Aluminum foil used for manufacturing thermal insulations in the construction

Research Balfour Beatty plc Essay Example | Topics and Well Written Essays - 2000 words

Research Balfour Beatty plc - Essay Example In the year 2002,civil engineering accounted for almost 38%, building services 35,and rail engineering 27% of the total profits acquired by the organization. (Corporate Watch, 2006) Balfour Beatty, founded by George Balfour and Andrew Beatty, mechanical engineer and a charted accountant by professions respectively was initially into making streetcar lines. However, the world war –II brought the construction of streetcar lines to a halt and brought about a stalemate situation in the company. A landmark decision was taken at that point of time to expand into the civil construction arena. Balfour Beatty also played an instrumental role in the early 1920s in managing various power corporations across Great Britain into construction of a common â€Å"grid† in Britain. Balfour Beatty was acquired by BICC, a cabling company in the year 1969.Balfour Beatty was a subsidiary and accounted for more than half of BICC’s revenues. In 1999, BICC’s cabling operations were at a sagging low and the company decided to divest their cable operations. In the year 2000, BICC changed its name to Balfour Beatty plc.

Trinitarian Theology of Prayer and Healing Essay Example for Free

Trinitarian Theology of Prayer and Healing Essay There has been considerable reflection more recently on the nature of Trinity and its place in church life and theological thinking. Feminists, liberationists, process thinkers, and more traditionalist Catholic and Protestant theologians as well as Eastern Orthodox desire to free the Trinity from its isolation in traditional statements with the consequent lack of relation to practical Christian faith and life. The realization that in the economy of salvation we have to do with God as he is in himself has radically focused thought in a new way on the being and act of God as triune. The double context of salvation and liberation in relation to the Trinity has been the prime reason for renewed interest in the doctrine today and in its practical implications. Recent rejuvenation of the Trinity has owed much to the efforts and success of theologians in laying out a wide range of trinitarian implications. It is as we properly understand God as triune that we win have a right view of the faith, of its doctrines, and of the relevance of all this for every sphere of human life and activity. It is in many ways remarkable that this insight, always latent in our traditions, has now, almost suddenly and unexpectedly, emerged as a central aspect of current theology. Current thinking is very varied; here the work will concentrate on that which relates directly a trinitarian basis and the implication for our understanding of the nature and goal of healing. Before we go on to do this in some detail in the work, we must say something about the Trinity itself as the general framework for understanding religious diversity. After discussing that general framework, we will indicate some of its implications for Christianitys internal life. Trinity means the reality of one God who is three persons. There are not three Gods somehow joined together, which would be explicit tritheism, nor can one envisage the three persons as together making up the Deity. This would reduce the â€Å"persons† to partial gods and mean that the Trinity was some kind of mathematical conundrum. Nor can the unity in Trinity be seen as simply a variety of attributes or perfections which constitute the being of God. Rather, the Trinity affirms that while each person is wholly divine both per se and in relation to the others, there is only one God. Gods being is a unity in Trinity and not otherwise. This naturally excludes the view that one can begin with a different conception of unity to which the Trinity must in some measure conform. It also indicates that the being of God as one can only be known as mystery in the actions of his grace and salvation in Jesus Christ by the Holy Spirit or, to put it otherwise, in revelation and reconciliation. But if God is the one God as the Father sending the Son by the Holy Spirit, how do these three persons or ways of Gods being in action express his unity? That is the question. Two main answers have been given but elaborated in various ways. The first favored by the Orthodox East and by many Western theologians today is summarized cryptically as â€Å"being in relationship† or â€Å"being as communion† or â€Å"ontorelational unity† (Vanhoozer 188). The second traditional Western view sees the persons as inhering in the being of God as the focus of unity. Christians believe God is intrinsically relational. Salvation is communion with the triune God. Salvation is not a realization of pure identity, the unity of one absolute Self, a one without a second. That religious end would be relationless, because there is nothing outside the One with which to relate. Any relation of the One to something outside it could only be a diminishment or contamination of the divine perfection. Salvation is also not emptiness, the dissipation of any continuing consciousness of being at all. This too is a relationless end. In the first case there was one absolute with nothing/no one to relate with. In this case it is not the absence of an other that rules out relation, but the radical insubstantiality even of one. Instead of one without a second to relate with, we might regard this end as pure relation, with no â€Å"ones† — distinct persons or entities — to have the relation. These religious ends differ from salvation because they exclude relation itself, seeing it as extrinsic to religious fulfillment. In that light, salvation appears too interactive, too wedded to difference. Christians believe that the understanding of God as Trinity, the understanding whose catalyst is the incarnation of Christ, allows us to grasp key features of Gods character and Gods relation with us. If relationship itself is an impossible, unnecessary, or counterproductive religious aim, then this belief is in error. But if relation is truly an irreducible component of the religious end, then characterizations of God are not only passing tools. They are in some measure constitutive of that end. Salvation is shaped by a particular vision of the God with whom we are in relation. Here we glimpse the way in which Christ is integral to salvation, both embodying the relation with God that constitutes salvation and distinctively representing to us the nature of the God with whom we have communion in salvation. The Trinity is not about levels of divine being but about dimensions of God. Height, length, and width are features of a whole body and of every part of it, and yet the three are not the same. If emanations from God or acts of God are put on a ladder of being, then humans, who are farther down the ladder of creation, can relate only to the rungs immediately above or below them. Ultimate divinity lies further above and beyond. If the three divine persons of the Trinity are treated in this way, they become levels of being. But in fact no person of the Trinity is a lower or earlier step, and none is â€Å"less far in† to God. For the Christian, salvation is not passing beyond the Spirit to the Son or the Son to the Father. Salvation is participation in the divine life that is the communion among the three persons. The doctrine of the Trinity has its basis in Gods self-revelation in Israel and in Jesus Christ his Son by the Holy Spirit. In other words, it is to be found exclusively in this revelation as the Scriptures bear witness to it. This positive affirmation carries a negative within it. Since the unity of God is a unity in trinity no other conceived or supposedly proven unity of God is a Christian conception of the true God. Traditional doctrine has sometimes been at fault here. It brought a division into the whole conception of God beginning with a general doctrine of the one God and his attributes on the basis of some biblical material or philosophical proofs and then went on to speak of God as triune. This clearly has various dangers which are being recognized today. It could lead to the Trinity being subordinated to an already preconceived idea of God with a consequent weakening and undermining of its true nature in a modalistic way. Again, it could be seen as a creator God as Father being largely divorced from Son and Holy Spirit so that the Father was known otherwise than by faith, whereas Jesus Christ and the Holy Spirit were the true objects of our belief and worship. This could bring a serious division into our conception of the Trinity, endangering the equality and nature of the persons and misunderstanding their mutual relationships. This dichotomy in the doctrine of God meant a real difficulty too in relating it to Christian life, faith, and worship. Augustine considers what is involved in the perfection of the image of God in humanity when through exercise of the trinity of faith the mind is purified and comes to contemplate God the Trinity. The image of God in the soul is memory, understanding and love, which is manifested (and can never be ultimately lost) when the mind remembers itself, loves itself and knows itself, but which is truly the image because it is the capacity the soul has to remember, know and love God and it is in such cleaving to God that the image is perfected: When its cleaving to him has become absolute, it will be one spirit with him . . . The mind will be raised to the participation of his being, truth and bliss, though nothing thereby be added to the being, truth and bliss which is its own. In that being, joined to it in perfect happiness, it will live a changeless life and enjoy the changeless vision of all that it will behold (Cavadini 103). What is happening here is less the souls ascent to God than the souls submitting to be refashioned by God: â€Å"the beginning of the images reforming must come from him who first formed it. The self which it was able to deform, it cannot of itself reform† (Cavadini 115). It is a process which begins in the moment of baptism, and is perfected in a long gradual process of penitence and endurance: â€Å"the cures beginning is to remove the cause of the sickness: and that is done through the forgiveness of sins. Its furtherance is the healing of the sickness itself, which takes effect by gradual progress in the renewal of the image† (Cavadini 121). The souls return to God is the perfecting within it of the image of God in which it was created. It is a movement away from the â€Å"land of unlikeness† in which it finds itself as a result of the fall. But Augustine emphasizes in the last book (XV) of De Trinitate that the likeness to God we have discovered in humanity is no equality: it is a likeness between two utterly different beings, God and the creature, and so he says, foreshadowing the language of the fourth Lateran Council, that we must â€Å"rather discern in its measure of likeness a greater unlikeness too† (Cavadini 122). For the love of God, beware of illness as much as you can, so that as far as possible your self is not the cause of any weakness . . . For the love of God, control your body and soul with great care, and keep as fit as you can. Here speaks the positive, life-affirming voice of Christian spirituality, in this case from plague-ridden England of the fourteenth century. The voice is also realistic: â€Å"should illness come in spite of everything, have patience and wait humbly for Gods mercy† (Peel 255). Between the twin poles of the passive acceptance of unavoidable suffering and the active care of health and work for healing, Christian spirituality moves with varying emphases, first in one direction, then in the other. In the twentieth century, Christian spirituality in its literature and practice has moved in the second direction, showing a more challenging attitude towards disease, and a wider concern for human development, personal and social. Wholeness in body, mind and spirit is presented as a goal to which ascetics need not run counter, and should indeed subserve. Wholeness and holiness, if not precisely synonymous, are regarded as related. â€Å"Properly understood, prayer is a mature act which is essential for the complete development of the personality . . . It is only in prayer that we can achieve the complete and harmonious union of body, mind and spirit† (Dr Alexis Carrel, quoted in H. Caffarel 20). The incarnation is seen to have implications for the redemption of every aspect of the worlds activity. At the same time, in society generally, a larger concept of health has begun to take hold, as meaning not merely the absence of sickness, but the realization of human potential. Advances in clinical medicine, pharmacology and psychiatry have helped to create a new climate of expectation. Partly through the growth of nuclear physics and a changed scientific and philosophical outlook, some writers have questioned the very distinction between the physical and the spiritual, as hitherto understood. It is in this changing atmosphere that the Christian ministry of healing, as distinct from forms of faith-healing which deny the value of scientific medicine, has been renewed in the churches. A fruitful meeting-point between spirituality and medicine lies in the fact that it is the vis medicatrix naturae, the recreative power of nature, which brings healing. Physicians and surgeons do not directly heal anybody: they seek by their skills to remove obstacles to natures healing energies, as when they correct chemical imbalances in the body, or take away diseased tissue. Means which touch the human spirit, such as are employed in the ministry of healing by prayer and sacrament, may equally be seen as seeking to liberate and quicken by grace the God-given forces within human nature. Three aspects of the subject attract attention, and developments in each can be expected. Christian Science arose at a time when Protestantism left little room for the teaching and practice of spiritual healing (Kelsey 69). It offered a unique product blend of metaphysics with an unorthodox interpretation of Christian scriptures that appealed to a large number of people during the late 19th century. With the inception of the Pentecostal movement early in the 20th century and its spillover into historic Christian denominations since 1950, healing was once again incorporated with orthodox Christian theology. Despite some obvious similarities between Christian Science and mainline Christian healing groups, very little rapport exists between the two approaches to religious healing. Christian Science accepts as an assumption that illness is a form of evil, and all evil is an illusion (Peel 254). Each person has it within her/himself to counter illusion with truth. As Christian Science foundress Mary Baker wrote: â€Å"That which [God] creates is good, and He makes all that is made. Therefore the only reality of sin, sickness or death is the awful fact that unrealities seem real to human, erring belief, until God strips off their disguise† (Peel 256). Faith in Gods power to heal has to reckon with the fact that there appear to be blocks in a disordered world and within human personality to receiving Gods healing energies. Such obstacles may be moral, in the form of unrepented sin. They may also be due to emotional disturbances caused by past wounds to the spirit. Inner healing is concerned to bring to light the causes of the inner pain; to help the sufferer to interpret them correctly; and to release the person from the emotional grip of the past. Prayer and meditation play a crucial part in this exodus from captivity. Deeper levels of the mind are reached in contemplative prayer, when the focus is upon God alone, and the soul waits upon him. Inner healing comes also in corporate worship, when the gaze is Godward and the worshipper is lifted by the Spirit out of self-centredness or narrowness of vision. Closer union with God in the depth of the spirit thus brings an integration of the whole person around the new Centre, and it is quite usual for physical health to be improved. Diseases are caught in a diseased society. Environment counts, for better or for worse. â€Å"It is cruel and false to brand every sufferer as a sinner: much suffering and sickness is due to the sin either of other persons, or of society in general† (Peel 269). There is in some churches a growth of less formal kinds of reaching out to minister to the sick in the name of Christ, alongside the sacramental ministries of Eucharist, anointing, laying on of hands, reconciliation of penitents, and occasionally exorcism. The dedicated use by every member of Christ of his or her personal gift of the Spirit enables the local church to become an actively healing community. Where some have a physical gift of healing through the hands (a phenomenon still little understood, though real), they may use it as members of a parish team, and are sometimes licensed by a bishop for a wider ministry. I believe that Jesus Christ is in fact constitutive of healing. Christ is constitutive of healing for all people who attain it. Christ is constitutive in this way not as some separate and additional actor besides God, but precisely as an expression of the triune life of God. Christ is one who comes from the triune life into human life but also one who brings human life into its fullest participation in the triune life. Christ is not extrinsic to the love of God, not only a representation of it, but also the working of it. Christ is in such unity with God that communion with God involves a fundamental relation with Christ. Healing is constituted solely by Gods everlasting love. Christ does not constitute healing; Christ represents the God who does. Ordinary Christian sacraments and preaching can only symbolize God by representing Christ. Christ represents God by constituting these lesser representations. Whereas they represent Gods love by also representing him, he represents Gods love by also constituting them. Christs special role is not to constitute healing but to constitute the Christian symbols for it. Other religions may have their own representations.   The problem with this analysis is that it makes â€Å"Gods everlasting love† an abstract quality and agent, some kind of prior decision in the mind of God, and downplays its personal nature. That love is precisely a feature of the personal communion that is the divine life, of which the second person of the Trinity is a constitutive member. Prior to being an idea or a decision, this love is an event. And Christ, the divine Word, is participant in that event, constitutive of that everlasting love. Likewise the extension of this love to humanity which constitutes healing is not an abstract possibility. The path for human participation in the triune communion is laid in the unity of God and humanity in Christ. Though Christ is certainly the way, in the Christian view, Christ is also the life and the truth in whom we rest and grow while on the way and at the end of the way. The proposition that Christ is the sole savior of the world is not adequately translated by saying that everyone must make use of Christ for at least one crucial moment, long enough to negotiate part of the passage to the promised land of â€Å"salvation,† after which time Christ can be discarded or replaced. In inviting his followers into a relation with God like his own, Jesus presumed that those in such relation were one body that they lived in him and he lived in them, just as Christ lived in God and God in him. Jesus did not counsel his followers to go out and independently approach God as Jesus did. Jesus invited them to share in that relationship by virtue of their connection with him. There is nothing purely instrumental about this: the images and substance are all organic. Communion is the way Christ saves, and it is the salvation that results. Healing seems to be restored as a normal part of the Churchs ministry and of the Christian experience, wherever the Church is alive with faith in Christ. But, as with the mission to evangelize the world, so with the healing work of Christ in his Church, opposition abounds and the story is one of failure as well as success. God reigns, and the word is preached with signs following. But the end is not yet, and in Christian perspective the total healing of people and nations waits for the consummation of all things, when God shall be all in all. Deep dialogue with others can begin with prayer, the deepest dialogue with the Ultimate Other. Within this deepest dialogue, active and receptive prayer processes proposed by the Relational Prayer Model have been related to eastern and western historical descriptions of the prayer of the Holy Name. A comparison of the method and function of the prayer of the Holy Name has revealed several similarities between eastern and western spiritual traditions. These points of common ground between spiritual traditions support the expansion of the original Interpersonal Christian Prayer Model to account for more than a solely western spiritual tradition. In addition, intercultural religious dialogue and prayer between eastern and western spiritual traditions has been developed with several examples. Such religious enculturation could lead to further development and/or revisions of the Relational Prayer Model. Most modern perspectives on the Trinity and worship see prayer as a central aspect of this relationship. The passages in the New Testament that distinguish most clearly between the Father, the Son and the Holy Spirit are those that deal with prayer. Christ as our reconciler and peace giver is the one through whom we have access by one Spirit to the Father. â€Å"It was when he was thinking about prayer that Paul also thought about how in their different ways the Son and the Spirit enable us to approach the Father† (Thompson 70). While all three persons in the Trinity are necessary properly to speak of God as one it is primarily to the Father that the Son and the Spirit lead us in prayer. This is summed up by Paul when he says, â€Å"God sent the Spirit of his Son into our hearts crying Abba, Father† Thompson 65). Central to this is the Son, who reveals the Father, and whom, when we see, we see the Father. This leads us back to our Lords Prayer and his relation to God where the distinctive name he gives him is â€Å"Father.† Prayer is â€Å"through Jesus Christ our Lord,† that is, through all he was and said and did in his fife, death, and resurrection. He is the way, as well as the truth and the life. If prayer is to the Father and through the Son, it is enabled by the Spirit. Only the Spirit enables us to know God as Father or to confess Jesus as Lord or to pray to the Father in a way that is acceptable to him. The role of Son and Spirit in this is profoundly expressed in Romans. â€Å"Christ who died for us is now our great High Priest and Intercessor by his presence with the Father in the power of his finished work on the cross† (Thompson 96). Yet we can know this and be able to enter into its meaning only by the Holy Spirit. He is the One who lays hold upon our weaknesses by his strength and intercedes for us with sighs too deep for words. Through Christ we become children of God and this relationship is made possible, continued, and brought to its completion by â€Å"his Spirit which dwells in you† (Thompson 98). He is the gift and power of the present and the hope of immortality. It is the Spirit (who is divine) who intercedes for us. God the Father who knows us and our weaknesses knows his own Holy Spirit and God, speaking to us through God, as it were, prays for us and with us as the Spirit, as God wants and as prayer ought to be. At the same time, paradoxically, it is not simply the Spirits prayer but ours as well. So close is the work of Son and Spirit in bringing us to the Father that each is spoken of as Advocate and Intercessor. The trinitarian aspect of prayer has profound significance for worship. It is not seen primarily as our work but Gods own gift through Christ and the Holy Spirit. Thus â€Å"prayer and worship are not primarily hard tasks that God sets us; they are gifts that through his Son and in his Spirit he shares with us† (Thompson 99). The triune God in his life is both one and three in his being and relationships. This insight is applied in relation to the church in two areas, the local and the universal. The New Testament speaks not only of the church but also of the churches. By this is not meant denominations in our modern sense of the term, but the various ecclesiae, the various local communities wherever found. In this sense the churches represent the universal church. Each particular congregation shares in this fullness and totality in both locality and universality. In the diversity of churches or communities the one church appears in each place. One can put it in picture form by saying that the whole universal church looks out in the local church. The Conference of European Churches (C.E.C.) made the point clearly: â€Å"The whole church of Christ is constituted not by adding together part church to part church, but is expressed by the communion of local churches in mutual interpenetration. Conciliar community of churches is thus an integral part of the concept of the trinity† (Bockman 89). By this it means not that church can and should seek to live by and for itself   but, by its very basis and existence, is one with the church universal and must express that relationship analogous to the Trinity, in concrete structured form, however one may interpret this. â€Å"The primary goal of the participation of the church in the mission of God is, as expressed by Christ in his missionary mandate, to make disciples† (Bockman 89). Put otherwise, it is to bring men and women into living fellowship with the triune God and with one another through him. The church is thus not a static product of the Spirits work, but a dynamic instrument in the service of others. â€Å"You are Gods own people that you may declare the wonderful deeds of him who called you out of darkness into his marvelous light† (Bockman 89). The church is, on the one hand, the provisional result of mission but, on the other hand, it is Gods agent of it. The goal of the church is thus not itself but the world. The church participates in Gods mission to bring to humankind righteousness and salvation and to reconcile a broken creation. There are many avenues for the interpretation of religions. The distinctively Christian way passes through the trinitarian dynamic we have been describing, the heart of a Christian theology of religions. We saw that Trinity is a non-reductive religious ultimate, in whom the three persons and their unique relations subsist as co-equal dimensions of a single communion. This is like a musical polyphony, a simultaneous, non-excluding harmony of difference that constitutes one unique reality. Each voice has its own distinctive character by virtue of its relation with the others. We can equally well say that each receives its special voice by participation in the oneness of the whole musical work. In the trinity we are dealing with three subjects who are reciprocally conscious of each other by reason of one and the same consciousness which the three subjects possess, each in his own proper way. This means that Father, Son, and Holy Spirit are conscious of one another through their united consciousness and possession of the one divine essence and therein lies the unity of God. This does not go as far as either the Eastern tradition or the statement of Torrance. It is impossible to overemphasize the importance of the Christian doctrine that God is one in three persons. This has correctly been called the teaching distinctive of the Christian faith, that which sets the approach of Christians to the â€Å"fearful mystery† of the deity apart from all other approaches. To be human is to be separated from God in some degree. To be Christian, the Christian believes, is to be separated from him least. The knowledge of the Trinity which we have from the New Testament is above all personal. We are introduced to the Three and invited to share the happiness of the divine company. This is truly the great mystery of Christianity, the mystery of love. In the New Testament there is none of the remoteness in conceiving God which today tends to separate Christians from their triune Lord. Bibliography Bockman, Peter Wilhelm â€Å"Trinity, Model of Unity Relationship between Unity and Communion the Universal and the Local,† in The Reconciling Power of the Trinity, p. 89. Cf. Moltmann. Cavadini, John â€Å"The Structure and Intention of Augustines De Trinitate,† Augustinian Studies 23, 1992. Dr Alexis Carrel, quoted in H. Caffarel, The Body at Prayer. London, SPCK, 1978. Kelsey, Morton T.   Psychology, Medicine Christian Healing. San Francisco: Harper Row, 1988. Peel, Robert.   Spiritual Healing in a Scientific Age. San Franciso: Harper Row, Publishers, 1987. Thompson, John. Modern Trinitarian Perspectives. Oxford University Press: New York, 1994. Vanhoozer, Kevin J. The Cambridge Companion to Postmodern Theology. Cambridge University Press: Cambridge, England, 2003. Endnotes Bockman, Peter Wilhelm â€Å"Trinity, Model of Unity Relationship between Unity and Communion the Universal and the Local,† in The Reconciling Power of the Trinity, p. 89. Cf. Moltmann. Cavadini, John. â€Å"The Structure and Intention of Augustines De Trinitate,† Augustinian Studies 23 (1992), 103-23. Dr Alexis Carrel, quoted in H. Caffarel, The Body at Prayer ( London, SPCK, 1978), 20. Kelsey, Morton T., Psychology, Medicine Christian Healing, (San Francisco: Harper Row, 1988), 69. Peel, Robert, Spiritual Healing in a Scientific Age, (San Franciso: Harper Row, Publishers, 1987), 254-69. Thompson, John, Modern Trinitarian Perspectives, (Oxford University Press: New York, 1994), 69-85. Vanhoozer, Kevin J., The Cambridge Companion to Postmodern Theology, (Cambridge University Press: Cambridge, England, 2003), 188.

Application of Database Developmental Cycle

Application of Database Developmental Cycle Task 1: Apply the database developmental cycle to a given data set or a case of your own Myreadingroom[1.1] details that the database development lifecycle, DDLC, contains six phases: the initial study, the design, implementation and loading, testing and evaluation, operation, and maintenance and evolution. The first phase of the DDLC is the initial study. This involves investigating the companys current solution, determining what is causing it to fail and providing a future solution to resolve the issues, whilst ensuring that it is in the companys capabilities. This can be achieved in four stages: analysing the company, defining the problems and constraints, defining the objectives, and defining the scope and boundaries. To analyse[1.6] is to examine something methodically and in detail. An understanding of what is currently in place helps to decipher the problems and constraints of the current way of working, whilst helping to determine what the companys objectives are. Whilst developing a database there is always an objective[1.7], something planned to be achieved, or there can be several, depending on the requirements. During the initial study consideration should be made as to what the the desired outcome is, as well as the scope and boundaries of the solution. The issue I have been asked to resolve is that there is no way for my client to determine if they have, or want to purchase, a dvd, blu-ray or tv series. The objectives they have defined for the outcome is a fully functional system which allows a users to view and update a media. My client also requires the ability to generate a wish list, as well as view a list of all current media. The solution I have proposed is a Microsoft Access database as there are minor limitations to the system. The only limitation I believe may occur is that the data held may grow to be astronomical so a desktop database application may not be sufficient in the long term. A review should be undertaken throughout the lifecycle of the application to determine if it needs to be transferred to a relational database, hosted on a server. As Access allows you to customise the database to your requirements, my understanding is that there will be no limitations of the data stored. The second phase is the design[1.1]. This is defined as the most crucial phase in the database development lifecycle as this phase revolves around ensuring that the users requirements and objectives are met. If they are disregarded by the system developer, it would ultimately be deemed a failure and the DDLC should commence again. The implementation and loading phase of the database development lifecycle consists of installing the database management system, creating the database and loading, or converting, the data. Installation of the database platform should only occur if it is required. If the platform is already existent, or the install of the database has taken place, creation of the database can occur. The proposed design of the application is a main table which is essentially based on a series of lookups from other tables within the application. This is to ensure data integrity and remove any duplication that may otherwise need to occur. As part of the proposal for the table layout and relationships, consideration should be made as to the performance of the system. Due to Microsoft Access being preinstalled as part of Office, an installation does not need to occur, however creation of the database, designed in the previous phase, is required. The proposed solution for the application is as follows, with each relationship defined utilising a one-to-one relationship[1.8], where a row in one table is linked to one and only one row in another. From there the data needs to be loaded, and possibly manipulated, into the database. As there is no current solution in place a request has been given to my client in order for the main core data to be imported. Once this has been completed, data should be added through the application itself. The third phase, testing and evaluation, consists of testing the solution, tuning the database and finally evaluating the database and its application program. Testing is often referred to as User Acceptance Testing, UAT, in Yorkshire Coast Homes and involves both yourself and the superusers reviewing the system to determine if it is fit for purpose and if navigation throughout is fluid. From there, the system needs amending to introduce any of the anomalies found as part of UAT. My client will undertake the testing of the application which involves ensuring that data is able to be added to system, without any errors or having to go back to any previously accessed fields. In addition to this, they should also review if the application performs adequately and transactions are easily completed without delay. The penultimate phase is operation, which is essentially making the system live and operational. This involves the superusers training any users, within their department, how to use the system to undertake their job role. This results in the application moving from a project state to becoming part of the day to day workings of a department. As my client is going to be the only user of the database at launch, no training needs to occur; and the transition to live should have minimal impact to them as they have worked alongside myself to deliver the application. Throughout the lifecycle of the application being used, maintenance needs to occur and the application needs to evolve as the industry does. This phase is known as maintenance and evolution. Google[1.2] informs that the purpose of system maintenance is to sustain the capability of a system to provide a service. This phase consists of four maintenance types, which will occur as regularly as required. They are periodic, corrective, permissions and adaptive. Periodic maintenance refers to something of a regular occurrence. For example, in Yorkshire Coast Homes, the main housing system has a regular nightly queue which imports any monies received from customers and processes each night, alongside abandoning any no longer required repairs. Another example of periodic maintenance, which should occur in any organisation, is a backup[1.3], the copying and archiving of computer data so it may be used to restore the original after a data loss event. These can occur as regularly as an organisation requires. Periodic maintenance is partnered with corrective maintenance. This is most commonly known as recovery[1.4], the process of salvaging inaccessible data which has been lost, corrupt, damaged or formatted. As a database administrator you must always be prepared to restore any loss of data for any user, however this form of maintenance should only occur as and when required. The permissions element of maintenance consists of three aspects: adding, amending, removing and reviewing. Each aspect of the permissions are closely linked as a user may change job roles, requiring the adding or removing of permissions, or a third party decision may require a change. An example of where this has occurred in Yorkshire Coast Homes is access to tenants rent accounts. As part of a historic decision, everyone within the organisation had access to the rent account. Following a change in the law, users permissions were removed so that those who can access it are only those who require it within their job role, whether it be for informing a tenant of their rent, chasing any arrears or for IT to support any technical issues. The final maintenance type is adaptive. This is the process of adding features to the current system, or enhancing it. This can also be referred to as evolution. This is the process of the system evolving throughout time as either an organisation, or the technology utilised, advances. An example of where this has occurred in Yorkshire Coast Homes is our Total Mobile solution[1.5], a digital workforce management solution. We recently upgraded to the latest version of software, as the version we were previously running was old technology, which didnt support Android. Through the final phase of DDLC for the Media Database, the periodic maintenance that should occur is the copying of the database. This is to provide a recovery point in the event of data corruption or loss of data. Both the permissions element and adaptive maintenance have limited impact on the application. Currently only one user accesses and updates data, however periodic reviews should be undertaken to determine if my client requires further users to have access. From there, adaptive maintenance may need to occur to lock down certain parts of the system my client may not want users to access. In addition to this, Microsoft may upgrade the Access application which may potentially corrupt or remove a functionality currently used within the application. Reviews should be undertaken to determine if an upgrade to a new version of Access may corrupt the application. If a decision is made to undertake an upgrade, the DDLC lifecycle should commence again. Task 2b: Evaluate the effectiveness of the database solution and suggests methods of improvement My client asked me to produce a fully functional system which allows users to view and update a media. The solution I proposed was a Microsoft Access database which utilised relationships and joins, rather than duplicating data. The first objective, a fully functional system which allows a users to view and update a media, has been achieved utilising the Media Information form. As you can see from the screen print below the form details the title of the media, the media type and category. It also includes the purchase information and the genre(s). The second and third objective are closely related as my client requested the ability to generate a wish list, as well as view a list of all current media. This information can be accessed from the main form, as you can see from the print screen below. When selecting either the Wish List or Purchased icon the following report appears, detailing the information. As each of the objectives have been achieved, with the addition of my client being able to access sold media, I would deem the development of the database a success. One factor within applications that should always be considered is performance[2b.2], how well something works. There are three elements that I would deem beneficial to the applications performance. These are the storing of data, the navigation and functionality. When defining the tables and relationships in the design phase of the database development lifecycle, I ensured that the data is stored with a series of joins, rather than duplicated data. This data is then collated in a query and presented in a form to provide the information required to my client. This ensures data integrity[2b.1], the assurance of the accuracy and consistency of data. It also enables the end user to access the information required without having to navigate throughout the whole of the system. The application also benefits from having a limited number of ways to access the data. Providing the information required in one form, and a few reports, provides consistent information. As well as all of the information being provided, the inputting of information is simplistic as when entering data and moving through each field, it navigates in a top to bottom method rather than a muddled method. In addition to navigation through the form, navigation through the application is simple also. Each report and form has been provided with an exit icon, as well as the form having a create, save and delete button. These are controlled by macros. The macros have also been created in a managed way as rather than having multiple macros in one location, they are all their own macro. This removes the need for a triggered action to search a long macro before undertaking it, saving time and increasing performance. As well as successes in the system there are also failures[2b.3], the state or condition of not meeting a desirable or intended object. There are two failures which have simple resolutions. There are inputting data into the data dictionary form and the search functionality. In order for information to be entered into the data dictionary, the superuser must bypass the initial launch to display the tables. From there information can be entered into both of the data dictionary tables in order to update the related query. There are two issues with this method: firstly, having to enter data in both tables separately, and secondly, there is no password protection so anyone can update the tables. The solution for this issue would be to create an input form which its sole purpose would be to update the data dictionary. In addition to this, the form can be password protected so that only users with the password can update information. The second, and final issue, is the search functionality. As the database has minimal information currently, the only search available in the system is the one provided by Microsoft Access. As more information is entered, the harder it will be to locate the required media. The recommendation for this issue would be to provide a search option on the home screen with the ability to query any value within the database which may need to be updated, such as returning a list of wish list items. Although there is currently a report in the system available, this does not provide the ability to update the data. A form would be required for this. To conclude, the application is fit for purpose and meets the objectives defined by my client. However, there are some minor failures of the system which can be easily addressed. Task 2c: Provide supporting user and technical documentation Supporting your system The Media Information database is a desktop application database developed within the application Access, which is both provided and supported by Microsoft. Any issues relating to the core application is supported until Microsoft decide to cease cover, which is currently set to be October 2020[2c.1]. In the event support has expired, you can quite simply convert to the latest version of Access. In order to do this, make a copy of the database so you dont corrupt the information. With the copied database open, select File, Save As. Select the Save as type drop down menu and change it to the latest version. Ensure full testing is undertaken so that you know that functionality has not been lost, including adding new media types or genres. From there, you are able to delete, or archive, the previous database version. **Please note: DO NOT delete the previous database until testing has been completed, as it may result in corruption of your data** Overview The database provided is referred to as the Media Information database. It is a series of tables which logs whether a media type is owned, the format, genre, and many other things. Upon launch of the application, the following screen is displayed: This screen allows the user to navigate through the system. An exit application button is also provided to close the database. Upon selecting the Media Information icon the following screen is displayed: The main screen details the media title and any information held regarding it, including the status of purchase. Along the bottom pain, there is the ability to navigate throughout the records. In addition to this, the user has the ability to create, save and delete records. A Close button is also provided to return to the home screen. A number of blue boxes open the listed report for the user to peruse. Each report which opens correlates to the title detailed on each icon. The report displayed will look similar to this: As you can see from the screen above, there is also a Close button provided. This is available on each report to navigate back to the home screen. The final icon on the home screen is Data Dictionary. This report details, the table name, a description, what fields are included and the data type. The information is displayed as follows: Maintaining the database Throughout the lifecycle of a database, review and development must occur to determine if it is still fit for purpose. As a result, additional fields or tables may be added. If this is required there are a few things which need to be considered or remembered: The database is currently set up to provide lookups rather than having to manually enter information. This is the preferred method for data integrity. There are multiple relationships defined, detailed below You must remember to update the Data Dictionary tables Adding fields or tables is easily achievable through the backend, which can be accessed from the left hand panel of the application. The current tables in use are as follows: The core tables begin with Media, whereas those which help provide the Data Dictionary, begin with Data Dictionary. If you want to add additional tables into the system, try to add tables with a lookup to the original database. In order to do this, create your table with a primary unique key and the columns required. Then add the lookup column into the required table. For future reference, the database as it currently stands is configured like this: The main tables included and the relationships defined B) The data dictionary tables and the relationships defined Functionality help As part of the configuration for the forms and reports, there are a series of macros enabled which allow fluid interactions throughout the application, without having to exit it completely. These are the macros that are currently in use: When creating macros, ensure that a user friendly name is assigned to enable yourself, and support, to easily determine what it is for as a later date. This can easily be done by selecting the Properties of the tab and creating a description in the Caption field. This will ensure that it is displayed correctly in the macro overview window. In some instances, there may be things you dont know. As Office is one of the market leaders, there are many forums and online help sites available for use. The sites I would recommend are https://support.office.com/en-gb/access and https://answers.microsoft.com/en-us/msoffice/forum/msoffice_access?auth=1. If these sites do not provide the solution, Youtube is always an alternative or a Google search. References: [1.1] http://www.myreadingroom.co.in/notes-and-studymaterial/65-dbms/506-database-development-life-cycle.html [1.2] https://www.google.co.uk/search?ei=QbCXWN_AL4vQgAaC57GQDAq=system+maintenanceoq=syatem+maintenancegs_l=mobile-gws-serp.1.2.0i13k1l5.11736.12598.0.14403.8.8.0.0.0.0.149.897.1j6.7.0.01c.1j4.64.mobile-gws-serp..4.4.54735i39k1j0i7i30k1.g8bS8KwNeBs [1.3] https://en.m.wikipedia.org/wiki/Backup [1.4] https://en.m.wikipedia.org/wiki/Data_recovery [1.5] https://www.totalmobile.co.uk [1.6] https://www.google.co.uk/search?client=tablet-android-googleei=ZOaYWMLKJcLCwATvz5bwDAq=analyseoq=analysegs_l=mobile-gws-serp.3..0l5.14074.14927.0.15108.8.8.0.3.3.0.149.769.6j2.8.0.01c.1.64.mobile-gws-serp..1.7.466.3..41j0i131k1j0i67k1.uUVjfA3KtLw [1.7] https://www.vocabulary.com/dictionary/objective [1.8] http://www.databaseprimer.com/pages/relationship_1to1/ [2b.1] https://en.m.wikipedia.org/wiki/Data_integrity [2b.2] http://dictionary.cambridge.org/dictionary/english/performance [2b.3] https://en.m.wikipedia.org/wiki/Failure [2c.1] https://support.microsoft.com/en-gb/lifecycle?p1=13615

Immune System of a Plant

Immune System of a Plant ABSTRACT Two light signalling factors, FAR-RED ELONGATED HYPOCOTYL3 (FHY3) and FAR-RED IMPAIRED RESPONSE 1 (FAR1) regulate chlorophyll biosynthesis, seedling growth and modulate plant immunity by controlling HEMB1 expression in Arabiopsis thaliana. We show that fhy3 far1 double null mutants display high levels of reactive oxygen species, salicylic acid and high expression of pathogen related genes. We analyse the effects of this constitutively activated immune response on commensal microbial communities through use of a next generation sequencing based approach. We determine that fhy3 far1 mutants contain greater species diversity and a greater resistance against pathogenic bacteria. Fungal pathogens increase in abundance in fhy3 far1 mutants. Taken together, this study demonstrates the important role of FHY3 and FAR1 in commensal microbial community composition as well as the importance of bacterial fungal relations. INTRODUCTION The Microbiome Microorganisms are an extremely diverse group of organisms; making up an astonishing 60% of the Earths total biomass (Singh, 2009). Soil sustains as many as 4-51030 microbial cells (Singh, 2009), all contributing to soil structure formation, decomposition, and recycling of organic matter into its constituent elements and nutrients. Microorganisms present in the soil adjacent to plant roots are part of the Rhizosphere. (Garbeva, 2004) highlights their pivotal roles in the suppression of plant disease (Badri DV, 2009), promotion of plant growth (Lugtenberg, 2009), development and health (Mendes, 2011). Leaves usually dominate the aerial part of the plant, representing of the most significant terrestrial habitats for microorganisms: the Phyllosphere (Vorholt JA, 2012). A diverse community of bacteria and fungi inhabit this challenging habitat; with nutrient deficiency and fluctuations in temperature, humidity and UV radiation (Lindow SE, 2003). The microbial communities here are shaped by biotic factors: (Yang CH, 2001) states that species, genotype (van Overbeek L, 2008) and age of plant (Redford AJ, 2009) all have their respective impacts. Abiotic factors also have a profound influence over the communities present within the phyllosphere. Plant location and growth conditions such as soil composition and climate can also have a strong impact due to the physiochemical alterations they impart. (JH, 1999) also notes how plant genotype and phenotype has an impact on community assembly. Although the majority of communities exist on the plant surface, and are therefore epiphytic some exist within the plant as endophytes. Species present within the phyllosphere tend to assimilate plant derived ammonium, simple carbohydrates and amino acids, which are their primary nitrogen and carbon sources (Thomas R Turner, 2013). Microorganisms energy metabolism isnt entirely dependent on the plant; some species contain rhodopsins. Due to the abundance of processes which play a role in community composition (Weiher E, 2011), phyla with the best adaptations for survival and reproduction tend to predominate communities. These microorganisms can promote plant growth through the production of hormones, or protect plants from pathogenic organisms by producing antibiotic compounds, competing for resources (Berg G, 2009) or induction of systemic resistance (Conrath U, 2006). The use of Arabidopsis thaliana as a model organism has been vital for these studies (Innerebner G, 2011). A. thaliana is an annual forb, occurring at temperate regions worldwide in a diverse range of habitats (Elena Garcà ­a, 2013) In order to analyse microbial communities; a few terms need to be defined. Biodiversity is defined as the range of significantly different types of organisms and their respective relative abundance within a community, encompassing three main levels; genetic variation between species, number of respective species and community or ecological diversity (Harpole, 2010). Two main components make up species diversity: the total number of species present (species richness) and the distribution of individuals amongst said species (evenness). Operational taxonomic units (OTU) or communities provide information on an ecosystem (Mannan, 2013). Species diversity relates to the stability of a community; well organized communities tend to have the greatest stability (Yannarell, 2005). Stresses can cause disturbances in a homeostatic community, thereby disrupting it and leading to changes in species abundances. When characterizing an ecosystem such as A. thaliana, one must determine three things: T he type of microorganisms present, their roles and how these roles relate to the ecosystems function (Sani, 2011). Plant Immune Response The immune system of a plant has a selective effect upon its microbiome. Upon pathogen encounter, a plant will elicit an immune response with the goal of limiting pathogen growth. Biotrophic and hemibiotrophic pathogens (those who obtain nutrients from living host tissue) are repelled by Salicylic acid dependent defence responses. Necrotrophic pathogens (which kill their host to obtain nutrients) are sensitive to Jasmonic acid (JA) and Ethylene (ET) dependent defence responses (Christine Vogel, 2016). Plants lack specialised immune cells; therefore, their cells must have an ability to sense pathogens and mount an appropriate immune response. Pathogens are detected by pattern recognition receptors (PRRs) which bind to the microbe or pathogen associated molecular patterns (MAMP/PAMP), thereby issuing a layer of basal defence known as PAMP triggered immunity (PTI) to prevent pathogen colonization (Chuanfu An, 2011). In order for pathogens to cause disease, they must inject effectors int o plant cells, thereby interfering with PRR complexes or downstream signalling to overcome the PTI. Plants have evolved resistance proteins which recognise effectors directly or indirectly and induce effector triggered immunity (ETI). This response is far more specific, and is often followed by a hypersensitive response (HR). R proteins, mostly leucine-rich repeat (LRR) domain containing proteins and Nucleotide-binding (NB) proteins are the intracellular receptors which sense pathogen derived molecules (Heidrich K, 2012). Figure 1 shows a summary of these processes. When these proteins are activated, production of salicylic acid occurs. Salicylic acid (SA) is a phenolic phytochrome present in plants. SA holds roles in growth, development, transpiration, photosynthesis and the uptake of ions. Its also vital for the process of endogenous signalling, mediating plant defence against pathogens. Activation of defence signalling pathways causes the generation of mobile signals from the infected tissue, where they can spread to distal tissue. Here they can upregulate expression of pathogenesis related genes and induce systematic acquired resistance (SAR), a long-lasting immunity against a broad spectrum of pathogens. Sali cylic acid mediated immune responses are important factors of both PTI and ETI, essential for the activation of SAR. NB-LRR mediated disease resistance may only be effective against pathogens grown on living host tissue such as obligate or hemibiotrophic pathogens, but not against nectrotrophs (Dangl, 2006). Downstream of the NB-LRR R proteins, the pathways ENHANCED DISEASE SUSCEPTIILITY1 (EDS1) and its partner PHYTOALEXIN DEFICIENT 4 (PAD4) act in basal resistance and ETI initiated by Toll-like/Interleukin 1 receptor (TIR) type NB-LRR R proteins (Vlot AC, 2009). Both PAD4 and EDS1 amplify SA signalling through a positive feedback loop (Wanqing Wang, 2015). Coiled-coil (CC) type NB-LRR proteins are regulated by NONSPECIFIC DISEASE RESISTANCE 1. When SA levels increase as a result of pathogen challenge, redox changes are induced which cause reduction of NON EXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1) to a monomeric form which activates defence responsive gene expression by accumulating within the nucleus. This results in plant immunity (Fu ZQ, 2013). Most bacteria which colonize A. thaliana are not pathogenic however still produce MAMPs. It is currently not known how plants are able to tell apart pathogenic and commensal microorganisms, and whether the recognition of these non-pathogenic phyllosphere bacteria triggers plant immune signalling networks downstream of PTI or ETI activation, with knock on effects on community structure. (Christine Vogel, 2016) determined that in response to some non pathogenic species, the detection of MAMPS leads to no change in gene expression. Note that some species of bacteria can induce transcriptional changes to protect the plants from infections of other species (Judith E. van de Mortel, 2012). FHY3 FAR1 Plants have developed regulatory mechanisms in order to cope with adverse abiotic and biotic conditions (Bray EA, 2000), however these are a detriment to their growth and development. These regulatory mechanisms activate immune responses and resistance pathways in the case of biotic stress. Constitutive activation of plant immunity would lead to impaired growth and fitness, so in the absence of stress, the immune response must revert the massive transcriptional reprograming, requiring tight genetic control (Tian D, 2003). Arabidopsis thaliana has to adapt to changes of environmental stimuli, such as light signals or temperature. Light duration, direction, wavelength, and quantity are determined by a battery photoreceptors which monitor incident red (R, 600-700 nm) and far red (FR, 700-750 nm) light wavelengths. This is achieved by switching between R absorbing and FR absorbing modes through biologically inactive Pr and active Pfr forms (PH, 2002). Photo activation of the primary photoreceptor for FR light phyA, causes translocation from the cytoplasm to the nucleus. This translocation allows induction of FR-responsive gene expression required for various photoreceptors. Two pairs of homologous genes are essential for the phyA signalling; FAR1 (far-red-impaired response 1) and FHY3 (far-red elongated hypocotyl 3). (Hudson, 2003) determined that these genes encode mutator like transposase derived transcription factors which directly bind to the promotor region HEMB1, which itself encodes a 5-1minolevuli nic acid dehydratase, ALAD) and activates its expression, thereby regulating both chlorophyll biosynthesis and seedling growth (Tang W, 2012). These regulators small plant specific proteins, which are necessary for the nuclear accumulation of light activated phyA. (Wanqing Wang, 2015) determined that fhy3 far1 double null mutants display an autoimmune response; accumulating SA and ROS, inducing PR genes and having an increased resistance to pathogen infection. They all displayed a dwarf phenotype, with necrotic lesions developing on their leaves as a result of premature cell death. Wang and his colleagues determined that FHY3 and FAR1 may act as defence-responsive gene repressors; mutants had high abundances of R genes and upregulated levels of PR genes, hinting at a possible link with regulation of NB-LRR mediated SA signalling pathways. Fhy3 far1 mutants increased expression levels of EDS1, PAD4, SID2 and EDS5 all genes involved in SA pathways. Reduction of HEMB1 in fhy3 far1 lead to a constitutively activated immune response, inducing system acquired resistance. (Wang Q, 2007) hypothesized that FHY3 and FAR1 may negatively regulate SA signalling and plant immunity through regulation of HEMB1 expression providing a possible linkage between light signalling and plant immunity. Next Generation Sequencing Most microbial communities present within nature are yet to be cultured within a laboratory; thereby leaving biomolecules such as nucleic acids, proteins, and lipids as our only source of information. For phylogenetic studies, surveys of the small ribosomal subunits (SSUs) for bacteria and the internal transcribed spacer (ITS) region of fungi are vital. Ribosomal genes are present in all organisms and contain regions which evolve slowly, coupled with faster evolving regions which permit fine tuning of taxonomic levels, to either family or genera. Note, that there also exists numerous databases for reference sequences and their respective taxonomies, such as SILVA (Pruesse, 2007) and the Ribosomal Database Project. This technique uses multiple primer pairs for each of the marker genes, each associated with its own taxon (William Walters, 2015). SSU rRNA genes are the standard reference sequence for taxonomic classification; calculating similarity between rRNAs. ITS regions are primari ly sequenced for fungi due to the higher degree of variation they display as a result of low evolutionary pressure, and clear resolution below genus level (Bellemain, 2010). PCR amplification is performed, cloning and Illumina sequencing of the bacterial 16S rRNA and fungal 18S ITS performed and compared to databases hosted by NCBI to allow a benchmark for assessment of phylogeny (Cole JR, 2009). Illumina sequencing was chosen due to the low cost and sequencing quality (Gregory B. Gloor, 2010). (Wang Q, 2007) determined that longer sequences are easier to assign to taxonomic groups, in this case, reads of 300bp were determined. Illumina sequencing has two main technologies: HISEQ, which generates more reads but requires a longer time, and MISEQ which provides less reads but at a longer sequence length, reduced time and reduced cost, hence its use in this experiment. The workflow of Illumina has four basic steps; a sequencing library is produced by random fragmentation of DNA/cDNA samples, followed by ligation of 5 and 3 adapters. These adapters are amplified through polymerase chain reaction (PCR) and the gel purified. Libraries are loaded onto flow cells, binding to a lawn of surface bound oligonucleotides which are complementary to the library adapters. Each of these fragments is amplified into distinct clonal clusters by the process of bridge amplification. Single bases ar e then incorporated into DNA template strands. All the 4 reversible dNTPs are present during sequencing, natural competition reduces incorporation bias, thereby reducing error rates. Data analysis involves alignment of new identified sequence reads with a reference genome (Illumina, 2016). Predictions A previous understanding of the microbial communities to be expected on wild type Arabidopsis thaliana was vital in order to discern changes in community composition of fhy3 far1 double null mutant plants. Numerous studies have been performed to determine the microbiome of the rhizosphere and phyllosphere, mostly through the use of fingerprinting and clone libraries (Reisberg EE, 2012). Arabidopsis thaliana microbial communities have been studied at a genome wide level (Matthew W. Horton, 2014), due to potential ecological and agricultural interest particularly when it comes to micro biotic resistance. (Matthew W. Horton, 2014) determined that in wildtype Arabdopsis, the majority of OUTs are from families of Proteobacteria, Bacterioidetes and Actinobacteria. Common genera included Sphingomonas, Flavobacterium, Rhizobium and Pseudomonas. (J.M. Whipps, 2007) determined that the phylosphere was dominated by Alpharoteobacteria, Gammaproteobacteria and Bacteroidetes. Betaproteobacteria and firmicutes have also been noted to be present at high abundances. Acidobacteria, Actinobacteria and cyanobacteria have all been found in low abundances (J.M. Whipps, 2007). Fungal OUTs tend to be from Ascomycete classes Dothideomycetes and Sordariomycetes and the basidiomycete class Tremellomycets (Matthew W. Horton, 2014). A study by (Delmotte N, 2009) analysed what bacterial communities are most abundant in naturally occurring A. thaliana phyllosphere and discovered Methylobacterium, Sphingomonas and Pseudomonas to be the most prevalent. Commensals belonging to the genus Sphingomonas have been linked with protecting plants from pathogens (Innerebner G, 2011). Many of the genera are pathogenic; such as Epicoccum, Alternaria, Mycospharella, Fusarium and Plectspharella..Interestingly, a lot of these genera are seed transmitted, suggesting a reason for their permanent association with A. thaliana. Microbial communities are largely shaped around host genetics, with changes in genes relating to defence response yielding the greatest changes in microbial communities. Due to the fhy3 far1 double null mutants constitutively activated immune response, one can assume that the plant will have an enhanced resistance against pathogenic organisms. Materials and Methods Plant Material, Growth Conditions and Extraction of Phyllospheric Microbes The fhy3 far1 double null mutant line of Arabidopsis thaliana with a Nossen (No-0) ecotype was obtained from the Xing Wang Deng group at Yale university, New Haven, USA (Wang and Deng, 2002). Double mutant plant lines fhy3-4 and far1-2 were produced through 1-Methylsulfonyloxyethane (EMS)-mutagenesis by Hudson et al (1999). Plants displayed a dwarfism phenotype, necrotic lesions on their leaves and accumulation of both ROS and SA. Plants were grown in standard controlled environment chambers in white light at a Photon Flux Density of 164  µmol m-2 s-1 in short day conditions which correspond to 8 hours of light and 16 hours of darkness for 4 weeks. Plants were grown on a compost mixture consisting of 6 parts Levington M3 (Scotts, UK), 6 parts John Innes number 3 (Westland, UK), and 1 part (Sinclair, UK). Phyllospheric microbes were extracted according to the protocol from Zhou et al (1996). The above ground growing parts from at least six plants were pooled for each sample. 100 mg of above ground growing parts of WT and fhy3 far1 mutant plants, 2.7 ml of DNA extraction buffer and 10  µl of proteinase K (10 mg/ml) were added in falcon tubes. Tubes were shaken horizontally at 225rpm at RT for 30 mins. 0.3 ml of 5% SDS was added and tubes were incubated at 65 °C for 2 h with gentle mixing. The samples were centrifuged at 6,00 g for 10 min at RT and supernatants were collected. Pellets were extracted two more times after addition of 0.8 ml of extraction buffer and 20  µl of 5 % SDS. Tubes were vortexed for 10 sec, incubated at 65 °C for 10 min and centrifuged. Supernatants from all three cycles of extractions were combined and mixed with equal volumes of chloroform-isoamyl alcohol (24:1, vol/vol). The aqueous phase was recovered by centrifugation and precipitated with 0.6 volume of isopropanol at RT for 1 h. The pellet of crude nucleic acids was obtained by centrifugation at 16,000g for 20 min at RT. The pellet was washed with ice cold 70 % ethanol, dried at 37 °C and resuspended in sterile deionized water for a final volume of 500  µl. DNA extraction buffer contained 100 mM Tris-HCl (pH 8.0), 100 mM sodium EDTA (pH 8.0), 100 mM sodium phosphate (pH 8.0), 1.5 M NaCl and 1% CTAB. PCR for High-throughput Sequencing and Sequencing Analysis PCRs for bacteria and fungi rDNA-related sequences were performed in volumes of 20  µl, with 1 x GoTaq Flexi Buffer, 1.5 mM MgCl2, 200  µM dNTPs, 0.2  µM forward primer, 0.2  µM reverse primer, 1.25 units of GoTaq Flexi DNA Polymerase, 1  µl colony suspension and distilled water. To amplify bacterial 16S rDNA and reduced mitochondria- and chloroplast-specific rDNA-amplicons, two PCRs were run. PCR primer pair 63f 63f (5-CAGGCCTAACACATGCAAGTC-3) / 1492r (5-GGCTACCTTGTTACGACTT-3) used for amplification of bacterial, mitochondria and chloroplast specific rDNA amplicons. The degenerative primer 783r (5-CTACCVGGGTATCTAATCCBG-3) is a mix of nine primers (783r-a1 (CTACCAGGGTATCTAATCCTG), 783r-b1 (CTACCGGGGTATCTAATCCCG), 783r-c1 (CTACCCGGGTATCTAATCCGG), and 783r-a2 (CTACCGGGGTATCTAATCCTG), 783r-b2 (CTACCCGGGTATCTAATCCCG), 783r-c2 (CTACCAGGGTATCTAATCCGG), and 783r-a3 (CTACCCGGGTATCTAATCCTG), 783r-b3 (CTACCAGGGTATCTAATCCCG), 783r-c3 (CTACCGGGGTATCTAATCCGG)). The degenerative primer 783r was designed to reduce amplification of chloroplast 16S rDNA (Sakai et al., 2004). For amplification of fungal intergenic spacers, the primer ITS1-F (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC) (White et al., 1990) were used. Eventually, 200 ng of DNA per sample, consisting of 100 ng DNA from bacteria-specific primer PCR and 100 ng DNA from fungi-specific primer PCR, were sent for high-throughput sequencing using the Illumina MiSeq platform to the Department of Epidemiology and Biostatistics, Institute for Computational Biology, Case Western Reserve University, Ohio, USA. Data processing Samples S13 and S15 consisted of sequences from the fhy3 far1 double null mutant whilst samples S14 and S16 belonged to the wild type Arabidopsis thaliana. A collective total of 182218 and 496243 sequences were present for fhy3 far1 and wildtype samples respectively. The first 20,000 sequences of each of the four samples were retrieved from the raw FASTQ data files using the cut feature of NextGen Sequence Workbench (Heracle BioSoft, 2016). FASTQC High Throughput Sequence QC Report v0.11.5 (Simon Andrews, 2011-15) was used to analyse sequence quality. FASTQ sequences were converted to FASTA format with FASTQ to FASTA converter from the Galaxy platform (Gordon, 2016). Sequences with a Phred quality score under 20 were trimmed using default parameters of Trim Galore! (Krueger, 2016). Paired end reads were trimmed to discard the leading 8bp barcode. VSearch was used for sample dereplication (Rognes Torbjà ¸rn, 2015). Due to the composite nature of the samples (containing both bacterial and fungal reads), a method had to be devised to separate them. SILVAngs was used to provide data analysis for 16S bacterial amplicon reads through an automatic software pipeline using the SILVA rDNA database (Quast C, 2013). SILVAngs was unable to process the 18S ITS fungal sequences. Through the SILVA output, recognised bacterial sequences were determined for each sample. Using NextGen Sequence Workbench (Heracle BioSoft, 2016), these recognised bacterial sequences could be marked as contaminants and removed from the raw FASTA sequence data files, thereby leaving the fungal reads. Basic Local Alignment Search Tool from NCBI were used on the FASTA sequences (Altschul, 1990). Parameters were altered so that only the ten most similar alignments were retrieved per sequence. A pipeline was built using python and local copies of mapping files maintained by GenBank (Dennis A. Benson, 2005): ftp://ftp.ncbi.nih.gov/pub/taxonomy/gi_taxid_nucl.dmp.gz for corresponding taxonomic IDs for GIDs and ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz for matching taxonomic ID to scientific names. The pipeline functioned by converting genbank IDs to taxonomic ID and abundance count. The taxanomic ID was then matched to scientific names and defined to a taxonomic hierarchy. Sequences with an abundance under 3 were removed as singletons. Sequences assigned to A. thaliana chloroplast 16S rRNA gene or mitochondria were removed. Statistical analysis For diversity computation, samples were rarefied to the sample with the lowest sampling effort (3390 for fungal and 4988 for bacterial). Diversity indices, richness estimators, rarefaction curves and eigenvector techniques such as principal component analysis were all performed using PAST 3.14 (Hammer, 2001). Wilcoxon Signed-Rank test was performed using IBM SPSS Statistics (IBM Corp, 2013). Heatmaps were generated using (Wahlestedt, 2016). Krona plug in was used for abundancy chats (Ondov BD, 2011) Results Statistical Analysis of Bacterial Communities Statistical analysis at a genus level indicated the following. Rarefaction curves showed a lack of sampling depth in fhy3far1. Diversity t tests determined that fhy3 far1 mutants displayed a greater diversity in comparison to wildtype A. thaliana, with a Shannon index of 3.51 and 2.85 respectively. Dominance values indicate that wild type A. thaliana contained select few genera which dominated the sample size. Simpson_1-D indicated that fhy3 far1 mutants possessed the greatest amount of sample diversity, though only marginally (0.95 and 0.91 respectively), whilst Evenness was highest in wildtype. Shannon index determined that fhy3 far1 samples had greater alpha diversity, confirmed by a Chao-1 score of 222.7, indicating greater species richness. Beta diversity was also greater in fhy3 far1. Alpha diversity indices are all displayed in table 1. Wilcoxon Signed-Rank test was performed with the null hypothesis that wild type and fhy3 far1 samples would contain similar bacterial community composition. The results indicate that the fhy3 far1 plant had 165 species with a higher abundance than in wild type A. thaliana. Test statistics indicated that fhy3 far1 contained a statistical difference in microbial abundances (P Principal component analysis at a phylum level revealed that PC 1 (98.5%) and PC2 (1.46%) were able to explain 99% of the variation. The result indicated a higher association of Baceroidetes and Acidobacteriales with fhy3 far1, separating it from the wild type which had higher correlation with Actinobacteria and Firmicutes. At a genus level (figure 2), wild type A. thaliana is correlated with Bacillales, Bacillus, Brevibacterium, Sphingomonas, Rhizobiales and Lysobacter. Genera associated with fhy3 far1 were determined to be Devosia, Advenella, Chitinophaga, Shinella, Rhizobium, Pricia and Pedobacter. Discussion Despite Arabidopsis thaliana having been studied for over 20 years in respect to the mechanisms of its immune responses (Kunkel, 1996), its not until the works of (Joel M. Kniskern, 2007) and (Matthew W. Horton, 2014) that an insight into the natural bacterial and fungal communities of A. thaliana was made. The aims of this project were to determine the commensal bacterial and fungal communities of A. thaliana and investigate the effect of the fhy3 far1 mutants constitutively activated immune response on said communities. In this study, we characterized the phyllosphere of wild type and fhy3 far1 mutant Arabidopsis thaliana using an Illumina sequencing survey of 16S rRNA and 18S ITS genes. To explain the results observed, we had to examine the effects of a constitutively activated immune response. The fhy3 far1 double null mutant has no way of negatively regulating SA signalling, this is due to the fact that FHY3 and FAR1 negatively regulate both stress and defence responsive genes, some of which are involved in the SA signalling pathway (EDS1, SID2, PAD4 and NDR1) (Wanqing Wang, 2015). This also induced the expression of a large amount of CC-NB-LRR and TIR-NB-LRR type R proteins. Many of these R genes will encode for protein homologs which mediate resistance against specific genera of bacteria and fungi. Some gene products can contain pathogen growth by indirect means; reinforcing the defensive capabilities of host cell walls and inducing stomatal closure (Jorg Durner, 1997). Alternatively, R gene products which have direct effects are usually antimicrobial metabolites (phytoalexins), papillae formation and induction of JA signalling and HR. Due to ETI being a direct tailored response to specific effectors detected by R proteins, it stands to reason that the activation of R genes will have a more profound effect on pathogenic species producing effectors. ETI commonly leads to an apoptic hypersensitive response, as observed by the necrotic lesions (Jorg Durner, 1997). As non-pathogenic species are unlikely to produce effectors (Toni J. Mohr, 2008), they wont receive an ETI response and therefore may be resistant to the immune response. Alternatively, non-pathogenic species may possess a suite of effector proteins which allow the nonpathogen to overcome some host defence systems (Grennan, 2006).The reactive oxygen species accumulation can be seen as the plants establishment of defence, strengthening host cell walls by cross linking glycoproteins, or act as executioners of pathogens by lipid peroxidation and membrane damage (Miguel Angel Torres, 2006). Alternatively, it may function as a plant signalling molecule, much in the likes of salicylic aci d. Constitutive immune activation reduces abundance of pathogenic bacteria, but not pathogenic fungi. Interestingly, we discovered that fhy3 far1 A. thaliana plants showed a decreased abundance of bacterial species associated with pathogenesis, thereby indicating that the effector triggered immunity response was effective and targeted towards pathogens. We were not able to show a specificity in plant response to non-pathogenic bacteria, as these too were affected by the ETI, seemingly without discrimination. Numerous reports indicate that the effects of plant defence processes on the microbiome are variable, with SAR being responsible for controlling the populations of some bacteria. (John W. Hein 2008) determined significant differences in rhizopshere bacterial community composition in A. thaliana mutants deficient in systemic acquired resistance (SAR), however, direct chemical activation of SAR by (Peter A.H.M. Bakker, 2013) caused little difference in community composition. (Joel M. Kniskern, 2007) analysed the effects of salicylic acid mediated defense induction, simmilarly to wh at we have tried to show in this experiment, conclusing a change in phyllospheric communities; notable a reduction in deiversity of endophytes, but higher epiphytic diversity, in concordance with our findings. We also concluded that the mutants constitutively activated immune response had no real effect on pathogenic fungi, in fact- the mutant hosted an increased abundance of pathogenic fungi. This was unusual due to the assumption that ETI would be targeted towards these species. This hints at the possibility that fungal communities are shaped by the bacterial communities present on the plant. It has been noted that SA and SAR do not contribute to resistance to necrotrophic pathogens (Joanna Ã…Â az ´niewska, 2010), however some literature contradicts our findings. Bacterial community diversity is increased in fhy3 far1 A. thaliana Our initial survey of the wild type bacterial communities of A. thaliana in samples 14 and samples 16 revealed a disparity in initial composition, however a Wilcoxon Signed Ranks test indicated no statistically significant difference between the two. 91 different morphotypes were detected and assigned to species on the basis of 16S sequence alignment. The most abundant species, Bacillales and Bacillus from the order Bacillalesare unusual in that they have not been previously described in A. thaliana. These high abundances are only from Sample 14, and were not observed in Sample 16. This may be a sequencing error or alternatively due to contamination. Bacillus have been described as mutually beneficial rhizobacterium in some plants; providing plants with growth promoting traits (Nathaniel A. Lyngwi, 2016). The Gammaproteobacteria of the genera Pseudomonas were found in a high abundance, a result which coincides with the literature (Matthew W. Horton, 2014) (J.M. Whipps, 2007). (Fumiaki Katagiri, 2002) has noted that Pseudomonas syringae is pathogenic to A. thaliana, triggering a hypersensitive response (HR) a rapid associated death of plant cells. The fhy3 far1 mutant showed a severe decrease in abundance; which could be associated to the over expression of Arabidopsis R genes: RPS2, RPM1, RPS4, RPS5 and PBS1, which mostly belong to nucleotide binding site-leucine rich repeat classes of R genes (Fumiaki Katagiri, 2002). (Wanqin

Cummins UK :: Business Management Studies

Cummins UK Cummins’ has many worldwide locations spreading widely into each continent. The European and Central Area Headquarters are located at Iver in Buckinghamshire. The Global Headquarters are located in Columbus in Indiana (USA). A map to show the location of the Cummins plant in Daventry is shown below. The location of the Daventry plant is in a central position in the country and is close to motorways, train-stations, and an International Airport (Birmingham). This makes it ideal for products and materials to be delivered and distributed throughout the country and onto other countries. The majority of Cummins’ employees are from Daventry. The unemployment level is 4.8% nationally, it is significantly lower in the Daventry district. The current unemployment rate in Northamptonshire is 1.7%. Before Cummins decided to set up a plant in Daventry they should have looked at the various aspects: †¢ Does Daventry have the qualified and skilled employees that Cummins need? †¢ Is the wage rate high in the Daventry area? †¢ Do we need to be near our customers? †¢ How much will it cost to set-up and keep running the plant in the Daventry area? Below is a map to show the location of Cummins in Daventry. It shows the surrounding roads which can be important to the location of a premises. Businesses set up in certain areas can gain by receiving grants. The government has sectioned the UK into Tier 1 and Tier 2. Tier 1 is the section in most need of grants because of high unemployment, lower earning levels. Tier 2 is the areas are more local areas of the country. Grant eligibility - the main factors There are a number of factors that affect the eligibility for grants. Location of your business Each of the countries of the United Kingdom has its own range of grants available. Some areas get extra grants due to social deprivation or high unemployment. Some grants are given by local authorities to help local businesses. Size of your business You may only be eligible for some grants if your business is a particular size, measured either by turnover or the number of employees. Many grants are limited to small or medium-sized enterprises (SMEs) - roughly one with fewer than 250 employees. Industry sector Grants are commonly targeted at industries that are economically disadvantaged. The government targets grants at industries they want to encourage. Grants rarely target retail businesses. Sales development increasingly attracts government grants, with an emphasis upon assistance to exporters. Grants are frequently targeted at manufacturing, farming and tourism. Businesses specialising in information technology and innovation are eligible for many grants. The purpose of the grant Grants are often awarded for a specific purpose such as purchasing